RegulonDB RegulonDB 10.9: Gene Sequence
cof gene sequence


Size: 819        A: 178  T: 220  G: 220  C: 201

Fasta

 

>cof E. coli K12. Version NC_000913.3 GI:556503834
atggctcgtctggcagcatttgatatggatggcactttattgatgcccgaccatcattta
ggtgagaaaaccctctctactttggcgcgactgcgtgaacgcgacattaccctcactttt
gccacggggcgtcatgcgctggagatgcagcatattctcggggcgctatcgctggatgcg
tatttgattaccggcaacggaacgcgcgtgcattctctggaaggtgaacttttacatcgt
gatgatttacctgcggatgtcgcggagctggtgctgtatcagcaatgggatacccgagcc
agcatgcatatcttcaatgacgacggttggtttaccgggaaagagatccctgcgttgttg
caggcatttgtctatagcggttttcgttatcagataatcgatgtcaaaaaaatgccactc
ggcagcgtcaccaagatctgcttctgtggcgatcacgacgatcttacacgcttgcagatc
cagctatacgaagcattaggcgagcgtgcacatttgtgtttttccgccacggattgcctc
gaagtgctgccggtgggctgcaataaaggcgctgcattgacggtgctgacccaacattta
ggtttatcgttgcgcgattgcatggcctttggtgatgcgatgaacgatcgcgaaatgtta
gtcagcgtcggtagcggatttattatgggcaatgcgatgccgcaactgcgcgcggagctc
ccgcatttaccggtgattggacattgccgaaatcaggctgtctctcactatttgacgcac
tggctggactatccacatctaccttattcccccgaataa
              
                            

Download fasta file
RegulonDB