RegulonDB RegulonDB 10.9: Gene Sequence
mdlA gene sequence


Size: 1773        A: 366  T: 449  G: 526  C: 432

Fasta

 

>mdlA E. coli K12. Version NC_000913.3 GI:556503834
gtgcgattatttgctcaattaagctggtatttccgtcgggaatggcgtcgctatctcggg
gctgtcgccttgcttgtcattatcgcgatgctgcaactggttccgccaaaagtggttggt
attgttgtcgatggcgtgacagaacaacactttactaccgggcagatcctgatgtggatc
gccaccatggtgctgattgccgttgtggtttatctcctgcgttacgtctggcgggtattg
ctgtttggtgcgtcttatcaactggctgttgaactgcgtgaagattattaccgtcagcta
agccggcagcatcctgagttttacctgcgtcatcgcaccggtgacctcatggctcgtgcg
accaatgacgtcgatcgcgtcgtgtttgccgccggagaaggggtgctgacgctggtggat
tcactggtgatgggctgcgctgtgttgattatgatgtctacgcaaattagctggcagttg
accttattttccctgttgccgatgccagtgatggcgatcatgattaagcgcaacggcgat
gctttgcatgaacgctttaagctggcacaggcggcgttttccagtcttaatgaccgcacc
caggaaagcctcaccagtatccgcatgatcaaagcctttggtctggaagatcgccagtcg
gcgttatttgccgcggatgccgaagataccggcaaaaaaaacatgcgggtggcgcgtatt
gatgctcgtttcgacccgaccatctatatcgcgattggtatggcgaacttgctggcgatt
ggcggcggtagttggatggtggtgcagggcagtttaacgctgggccagctcaccagtttt
atgatgtatttaggtctgatgatttggccaatgctggcgctggcatggatgtttaacatt
gtggaacgtggtagtgctgcgtacagccgtattcgcgcgatgctggcggaagcgccggtg
gtgaacgatggtagcgaacccgtgccggaagggcgtggcgaactggatgtaaatattcac
cagttcacgtatccgcagactgaccatcctgcgctggaaaacgtcaatttcgccctgaaa
cccggtcagatgctgggtatctgcgggccgactggttccggcaaaagtaccctgttgtcg
ctcattcagcgtcatttcgacgtcagcgagggggatattcgctttcatgatattcctctg
acgaagttacaactcgatagctggcgtagccgcctggcggtagttagccagacgccattc
cttttttctgacactgtggcgaataacatcgcgctgggttgcccgaatgccacccagcaa
gagattgagcatgtcgcgcggttagccagcgtacatgacgatattttgcgtctaccgcaa
ggttacgatacagaggtgggcgagcgcggtgtgatgctttccggcgggcaaaaacagcgt
atctccattgctcgtgcgttattagtcaacgcggaaatcctcatccttgatgatgcgctt
tcggcggtggacggacgcactgagcaccagatcctgcataacctgcgtcagtgggggcag
ggaagaacggtaatcatcagtgcccatcgcctttctgcactgacggaagccagtgaaatt
attgtgatgcagcacggacatatcgcccagcgtggcaatcatgatgtgctggcacaacaa
agcggctggtatcgcgatatgtatcgctatcaacaactggaggcggcgctcgacgacgct
ccggaaaatcgcgaggaggccgtcgatgcgtag
              
                            

Download fasta file
RegulonDB