RegulonDB RegulonDB 10.9: Gene Sequence
ybaZ gene sequence


Size: 390        A: 93  T: 86  G: 110  C: 101

Fasta

 

>atl E. coli K12. Version NC_000913.3 GI:556503834
atgctggtttcttgcgcaatgcgacttcactcgggcgtttttccagattatgctgaaaaa
ttacctcaggaagaaaagatggaaaaagaagattcatttccccaacgcgtctggcaaatc
gtcgccgctattcccgaaggctatgtcaccacttacggtgatgtggcgaaactggcggga
tcgccccgcgccgcgcgccaggtgggcggtgtgttaaagcgtctccctgaaggcagcacc
ttaccctggcaccgggtggttaatcgccacggcacaatttcgctaaccggaccggattta
cagcgtcagcgacaggcattactggcagaaggtgtgatggtatcgggaagcgggcaaatc
gacttgcagcgttatcgctggaactactaa
              
                            

Download fasta file
RegulonDB