RegulonDB RegulonDB 10.9: Gene Sequence
ybaP gene sequence


Size: 795        A: 193  T: 172  G: 211  C: 219

Fasta

 

>ybaP E. coli K12. Version NC_000913.3 GI:556503834
atggatctgttgtaccgggtaaaaacgctttgggccgcgctgcgcggtaatcattacacc
tggcctgccatcgatatcaccctccccggcaatcgccattttcatctgattggcagtatt
catatgggtagccacgatatggctcccctgcccacccgtttgctcaaaaagctcaaaaac
gccgatgcgctgatcgtcgaggcggatgtttccaccagcgatacgccttttgctaatttg
cctgcctgcgaggcgctggaagagcgcattagcgaggagcaactccaaaacctgcagcac
attagccaggagatgggcatttctccctcactcttttctacccaaccgctgtggcaaatc
gcgatggttcttcaggcgacgcaggcacaaaaactggggctgcgggcagaatacggtatc
gattaccagctattgcaggcggcgaagcaacaacataaacccgtgattgaactggaaggg
gctgaaaaccagattgccatgttgctccagctccctgacaaaggactggcgctgctggac
gatacgctgacccactggcataccaacgcacggttgctgcaacaaatgatgagctggtgg
ctgaatgcaccgccgcaaaataatgatataacgctgcccaatacgttcagtcagtcgctg
tacgatgtgctgatgcatcagcgaaatctcgcctggcgggataaattacgcgccatgccg
ccggggcgatatgtggtcgcggtcggtgcactacacctgtatggagaagggaatttgccg
caaatgttgcgctaa
              
                            

Download fasta file
RegulonDB