RegulonDB RegulonDB 10.9: Gene Sequence
copA gene sequence


Size: 2505        A: 539  T: 506  G: 813  C: 647

Fasta

 

>copA E. coli K12. Version NC_000913.3 GI:556503834
atgtcacaaactatcgacctgaccctggacggcctgtcctgcggtcactgcgttaaacgc
gtgaaagaaagtcttgaacagcgtccggatgttgagcaggcggatgtgtctatcactgaa
gcgcacgttaccgggactgccagtgcagaacagctgatcgaaaccatcaaacaagcgggt
tatgacgcatctgtaagccacccaaaggctaaaccgctggcggagtcatcaatcccgtcg
gaagcactgacagcggtttctgaggcgcttccggcagcgaccgccgatgacgatgacagc
cagcagttgctgctgagcggcatgagctgcgccagctgtgtcacccgcgtacaaaatgcg
ctgcaaagcgtaccgggcgtcactcaggcacgggtaaacctggcggagcgtactgcgctg
gtgatgggcagtgcctccccacaagatttagtgcaggcggtggaaaaagcgggctacggc
gcggaagcgattgaagatgacgctaaacgccgcgagcgccagcaagaaaccgccgtcgct
acgatgaagcgcttccgctggcaggcaattgtcgcactggcggtgggtatcccggtgatg
gtctgggggatgatcggcgataacatgatggtcaccgctgacaaccgcagcctgtggttg
gttatcggcctgataaccctggcagtgatggttttcgccggcggccatttttaccgcagt
gcatggaaaagcctgctgaacggtgcggcgacgatggatacgctggtggcgctgggtact
ggcgtggcgtggctctattcgatgagcgtcaacctgtggccgcagtggttcccgatggaa
gcgcgacatctttattacgaagccagcgcgatgattatcggtctgatcaatctcggccat
atgctggaagcgcgcgcacgccagcgttcttctaaggcgctggaaaagttactcgattta
accccgccgacggcacgcctggttactgacgaaggtgaaaaaagcgtgcctctggcagaa
gtgcagccaggtatgttgctgcgcctgacgaccggcgatcgcgtgccggtagatggcgag
attacccagggcgaagcatggctggatgaagcgatgctgacgggcgaaccaatcccgcag
caaaaaggcgaaggcgatagcgtccatgccgggacagtggtacaggacggcagtgtgctg
tttcgtgccagtgcggttggcagccatactacgctgtcacgaatcattcgcatggtgcgc
caggcccagagcagcaagccagaaatcggtcagctggcggataaaatctcagccgtattt
gtgccggtagtggtggttattgcgcttgtcagtgcggcaatctggtatttctttggtccg
gcaccgcagattgtctataccctggtgattgccaccacggtactgattattgcctgtccg
tgtgcgctggggctggcgacgccgatgtcgattatttccggcgtcgggcgggcggctgag
tttggcgtgctggtgcgggacgctgacgcgctgcaacgcgccagtacactcgacactgta
gtgttcgataaaaccgggacgctgactgaagggaagccgcaggttgtcgcagtgaaaaca
tttgctgatgttgatgaagcgcaggcattgcgtctggcggcggcactggagcaaggttcc
agccatccgctggcacgagcgatcctcgataaagcaggtgatatgcagctaccgcaggtc
aacggtttccgcacattgcgcgggctgggcgtgagcggtgaagctgaaggtcatgcgtta
ttgctgggcaatcaggcgctgttaaatgagcaacaggttggtaccaaagctatcgaagcg
gagattactgctcaggcatcgcaaggggcaacgcctgtgctgctggcggttgacgggaaa
gcggtagccctgctggcagtacgcgatccgttgcgtagtgatagcgtggcggcgctgcaa
cgcctgcataaagcgggatatcgtctggtgatgttgaccggggataacccaaccaccgcc
aatgcgatcgccaaagaagcagggattgatgaggtgatcgccggggtgctgccggacggt
aaagccgaagcgatcaaacatctgcaaagtgaaggacgtcaggtggcaatggtgggcgac
ggcattaacgacgcgccagcgctggctcaggcggatgtcggcattgcgatgggtggcggc
agtgatgttgccattgaaaccgcggcgattaccctgatgcgccatagcctgatgggcgtt
gcggatgcgctcgctatttcccgcgcaacgctgcacaacatgaagcagaacctgctcggt
gcgtttatctacaacagtatcggtattccggtcgccgccggtattttgtggccgttcact
ggaacactgcttaacccggtagttgccggagcggcaatggcgctctcgtcgattaccgta
gtgagtaacgccaaccggttgctgcggtttaaaccgaaggaataa
              
                            

Download fasta file
RegulonDB