RegulonDB RegulonDB 10.9: Gene Sequence
glsA gene sequence


Size: 933        A: 220  T: 217  G: 258  C: 238

Fasta

 

>glsA E. coli K12. Version NC_000913.3 GI:556503834
atgttagatgcaaacaaattacagcaggcagtggatcaggcttacacccaatttcactca
cttaacggcggacaaaatgccgattacattccctttctggcgaatgtaccaggtcaactg
gcggcagtggctatcgtgacctgcgatggcaacgtctatagtgcgggtgacagtgattac
cgctttgcactggaatccatctcgaaagtctgtacgttagcccttgcgttagaagatgtc
ggcccgcaggcggtacaggacaaaattggcgctgacccgaccggattgccctttaactca
gttatcgccttagagttgcatggcggcaaaccgctttcgccactggtaaatgctggcgct
attgccaccaccagcctgattaacgctgaaaatgttgaacaacgctggcagcgaatttta
catatccaacagcaactggctggcgagcaggtagcgctctctgacgaagtcaaccagtcg
gaacaaacaaccaacttccataaccgggccatagcctggctgctgtactccgccggatat
ctctattgtgatgcaatggaagcctgtgacgtgtatacccgtcagtgctccacgctcctc
aatactattgaactggcaacgcttggcgcgacgctggcggcaggtggtgtgaatccgttg
acgcataaacgcgttcttcaggccgacaacgtgccgtacattctggccgaaatgatgatg
gaagggctgtatggtcgctccggtgactgggcgtatcgtgttggtttaccgggcaaaagc
ggtgtaggtggcggtattctggcggtcgtccctggagtgatgggaattgccgcgttctca
ccaccgctggacgaagatggcaacagtgttcgcggtcaaaaaatggtggcatcggtcgct
aagcaactcggctataacgtgtttaagggctga
              
                            

Download fasta file
RegulonDB