RegulonDB RegulonDB 10.10: Gene Sequence
ybaT gene sequence


Size: 1293        A: 231  T: 373  G: 379  C: 310

Fasta

 

>ybaT E. coli K12. Version NC_000913.3 GI:556503834
atgatgaacacggaaggtaataacggtaacaaacctctcggtctatggaacgtcgtttcc
atcggcattggggcaatggtgggggcggggatcttcgcgctgctggggcaggctgcattg
ctaatggaagcctcgacctgggtcgcctttgcttttggcggtattgtggcgatgttttcc
ggttatgcctatgcgcgtctgggggcgagctatcccagcaatggcggcattatcgacttc
tttcgtcgcggattaggcaacggcgtcttttcgctggcgctctcgttactgtacctgttg
acgctggcggtgagcatcgccatggtcgcccgtgcttttggcgcttatgccgtgcagttt
ttgcatgaaggcagccaggaggagcaccttattttgctctacgcgttggggatcattgcg
gtgatgacgcttttcaactccttaagcaaccatgcggtagggcggctggaagtgatcctc
gtcggcattaaaatgatgatcctgttattgctgattattgccggtgtctggtcgctgcaa
ccggcgcatatttccgtctctgcgccccccagctccggtgcgttcttctcctgtattggg
ataactttccttgcctatgcgggctttggcatgatggcgaacgcggcggataaagtgaaa
gatccgcaggtcattatgccacgggcgtttctggtggcgattggcgttaccacgttgctt
tatatctcgctggcactggttttgcttagcgatgtatcggcattagagttagaaaaatat
gccgataccgccgtagcgcaggctgcttctccgctgctcgggcatgtgggttatgtgatc
gtcgtcatcggcgctttactggcgacggcttcagccattaacgcgaacctgttcgccgtg
tttaacatcatggacaacatgggcagcgaacgcgaactgccgaagctaatgaataaatcc
ctgtggcggcagagtacctggggcaacattattgtcgtggtgttgattatgctgatgacg
gcggcactgaatttaggctcactcgccagcgttgccagcgccacctttttgatttgctac
ctggcggtgtttgtggtggcgatccgcctgcgtcatgatattcacgcctcgttgccgatt
cttatcgttggtacgttggtgatgttgttggtgatcgttggctttatctacagtctgtgg
tcccagggtagccgtgcgttgatatggattattggctcactcttactcagccttattgtg
gcaatggtcatgaagcgcaataaaaccgtataa
              
                            

Download fasta file
RegulonDB