RegulonDB RegulonDB 10.9: Gene Sequence
ybbJ gene sequence


Size: 459        A: 82  T: 114  G: 158  C: 105

Fasta

 

>ybbJ E. coli K12. Version NC_000913.3 GI:556503834
atgatggagttaatggtcgttcatccacatattttctggctcagtctcggcggtttgctg
ctggcagccgagatgctgggcggaaatggttatttgttgtggagcggcgtggcagcggtg
attaccggcctggtggtctggctggtgccgctgggttgggagtggcaaggggtaatgttt
gccatcctgacgctgctcgccgcctggctgtggtggaaatggttgtcgcggcgggtgcgc
gaacaaaagcacagcgatagtcatttaaaccagcgcgggcagcagctgattggccgacgt
tttgtgctggaatctccgctggtcaacgggcgcggtcatatgcgcgtcggtgacagttca
tggcctgtcagcgccagcgaggatctcggtgcaggtacgcatgttgaagtcattgcgata
gaagggataaccctacatatccgagccgtctcgtcttaa
              
                            

Download fasta file
RegulonDB