RegulonDB RegulonDB 11.0: Gene Sequence
cnoX gene sequence


Size: 855        A: 205  T: 172  G: 261  C: 217

Fasta

 

>cnoX E. coli K12. Version NC_000913.3 GI:556503834
atgtccgtagaaaatattgtcaacattaacgaatctaacctgcaacaggttcttgaacag
tcgatgaccactccggtgctgttctatttttggtctgaacgtagccagcactgtttgcag
ttaaccccaattctggaaagcctcgcggcgcagtacaacgggcaatttattctggcgaag
ctggactgcgacgcggagcagatgattgccgcgcagtttggtctgcgtgcgattccgacc
gtgtatctgttccagaacgggcaaccggtagatggcttccaggggccgcaaccggaagag
gcgatccgcgccctgctggataaagtgctgccgcgcgaagaagagctgaaagcgcagcag
gcgatgcaactgatgcaggaaagcaattacaccgatgccctgccattgctgaaagacgcc
tggcagttgtcgaatcagaacggggagatcggcctgctgctggcagaaacgctgattgcg
ctgaaccgttctgaagatgcggaagcggtgctgaaaaccattccgttgcaggatcaggac
acccgctaccaggggctggtggcgcaaatcgaactgctgaagcaggcggctgatacgccg
gaaattcaacagttgcaacagcaggtggcggagaatccagaagatgccgcactggcgacg
caactggcgctgcaactgcatcaggttgggcgcaatgaagaggcgctggagttgctgttc
gggcatctgcgtaaagatctcaccgccgcagacggtcagacgcgtaaaacgttccaggag
atcctcgctgcgctgggtacgggtgatgcactggcgtcgaagtatcgccgccagctgtat
gcattgttgtattga
              
                            

Download fasta file
RegulonDB