RegulonDB RegulonDB 10.9: Gene Sequence
ybbO gene sequence


Size: 810        A: 191  T: 179  G: 236  C: 204

Fasta

 

>ybbO E. coli K12. Version NC_000913.3 GI:556503834
atgactcataaagcaacggagatcctgacaggtaaagttatgcaaaaatcggtcttaatt
accggatgttccagtggaattggcctggaaagcgcgctcgaattaaaacgccagggtttt
catgtgctggcaggttgccggaaaccggatgatgttgagcgcatgaacagcatgggattt
accggcgtgttgatcgatctggattcaccagaaagtgttgatcgcgcagccgacgaggtg
atcgccctgaccgataattgtctgtatgggatctttaacaatgccggattcggcatgtat
ggccccctttccaccatcagccgtgcgcagatggaacagcagttttccgccaactttttc
ggcgcacaccagctcaccatgcgcctgttacccgcgatgttaccgcacggtgaagggcgt
attgtgatgacatcatcggtgatgggattaatctccacgccgggtcgtggcgcttacgcg
gccagtaaatatgcgctggaggcgtggtcagatgcactgcgcatggagctgcgccacagc
ggaattaaagtcagcctgatcgaacccggtcccattcgtactcgcttcaccgacaacgtc
aaccagacgcaaagtgataaaccagtcgaaaatcccggcatcgccgcccgctttacgttg
ggaccggaagcggtggtggacaaagtacgccatgcttttattagcgagaagccgaagatg
cgctatccggtgacgctggtgacctgggcggtaatggtgcttaagcgcctgctgccgggg
cgcgtgatggacaaaatattgcaggggtga
              
                            

Download fasta file
RegulonDB