RegulonDB RegulonDB 10.9: Gene Sequence
ybbP gene sequence


Size: 2415        A: 465  T: 559  G: 784  C: 607

Fasta

 

>ybbP E. coli K12. Version NC_000913.3 GI:556503834
atgattgcacgttggttctggcgcgaatggcgttcgccgtcgctattaattgtctggctg
gcgctaagcctggcggtggcctgcgtgctggcgctgggcaatatcagcgatcgcatggag
aagggcttaagccagcaaagccgtgagtttatggcgggcgatcgggcgttgcgcagttca
cgcgaagtgccgcaagcgtggctggaggaagcgcaaaagcgcggcctgaaagtcggcaag
cagctgactttcgccacaatgacctttgcaggcgacacaccgcagctggcgaacgtcaaa
gcggtggatgatatctacccgatgtatggcgatctgcaaactaatccccctggcctgaaa
ccgcaggcgggcagcgtattgctggccccacgcctgatggcactgcttaacctgaaaacg
ggcgacaccattgacgtgggcgatgccaccttgcggattgccggagaagtgattcaggaa
ccggattccggttttaaccccttccagatggctccgcgtctgatgatgaatctggcggat
gtcgataaaaccggagccgtgcagccggggagtcgggtcacctggcgttataaattcggc
ggcaacgagaaccagctcgacggctatgagaaatggttgttacctcagcttaaacccgaa
caacgctggtacggtctggaacaggacgaaggcgcgctggggcgatcgatggaacgctcg
caacagttcctgctgctttcggcgcttctgaccttgctgctggcagtggcagcggtggcg
gtagcgatgaatcattactgtcgcagtcgctacgatctggtggcgatcctcaaaacgctg
ggggcagggcgagcgcaactgcgtaagctaatcgtcggtcagtggttgatggtgctgacg
ctttcagccgttaccggtggggccataggcctgttgttcgaaaacgtgttgatggtgctg
ctcaagcccgttctgcctgctgcactaccgccagccagcctctggccgtggctgtgggcg
cttggcaccatgacggtcatctcgctgctggtggggctacgaccatatcgcttgttgctg
gcaacgcagcctttacgcgtattacgtaatgatgtggtagcgaacgtctggccgctgaag
ttttatctgccgattgtcagtgtggtggttgtgctgctgctcgccggattaatgggtggc
agcatgctgctttgggcggtgctggcgggcgcggtagtactggctttgctgtgcggtgtg
ctgggctggatgctgctgaatgtacttcgccgcatgacgctgaaatcgctgcctctgcgc
ctggcggttagccgcctgttacgtcagccgtggtcaacgttaagtcagctttcggcattt
tcgctctcctttatgctgctggcactgctgctggtgttgcgtggcgatctgctcgaccgc
tggcagcagcagctacctccagaaagcccgaactactttttaattaacatcgccacagaa
caggtagcaccgctaaaagcgttcctcgcggaacatcagatagtcccggaatcgttttat
ccggtggtgcgggcgcggctgacggcgattaacgataagccgacagaaggtaatgaagat
gaggcgcttaaccgcgaactcaatcttacctggcaaaatacgcggcccgatcataatccg
attgtcgccggtaactggccgccaaaagccgatgaagtgtcgatggaagaggggctggcg
aaacgcttaaacgttgccctcggtgataccgtgacttttatgggcgatacccaggagttc
cgcgctaaagtgaccagcctgcgcaaagtggactgggaaagtctgcggcctaatttctat
tttattttccctgaaggggcattagacgggcaaccgcagagctggcttaccagtttccgc
tgggagaatggcaacggcatgttgacacaactcaaccgccagttcccgaccattagcctg
ttagatattggcgcgattttaaaacaggtcggtcaggtgctggagcaggtaagtcgggcg
ctggaagtgatggtggtactggtcaccgcctgcggtatgttgctgttgctggcacaggtg
caggtgggaatgcgtcagcgtcatcaggagctggtggtgtggcgcacactcggtgcgggg
aaaaaactgctgcgtaccacgttgtggtgtgagttcgccatgcttgggtttgtttccggc
ctggtggccgcaattggtgcggaaacggcgctggcagtgttgcaggcgaaagtgtttgat
tttccgtgggagccagactggcgattgtggattgttctgccgtgcagcggagcgctgctg
ctgtcgcttttcggcggctggctgggtgcgcgactggttaagggtaaggcgctgttcagg
cagtttgcggggtga
              
                            

Download fasta file
RegulonDB