RegulonDB RegulonDB 10.9: Gene Sequence
ylbH gene sequence


Size: 711        A: 221  T: 173  G: 197  C: 120

Fasta

 

>ylbH E. coli K12. Version NC_000913.3 GI:556503834
atgctggcgctgatggatgcggatggaaacattgcgtggagcggggagtatgatgagtgg
ggcaaccagctgaatgaagagaacccgcatcacctgcaccagccgtaccggctgccgggg
cagcagtatgataaggagtcggggctgtactacaaccggaaccggtactacgatccgttg
caggggcggtatatcactcaggacccgatagggctggaggggggatggagtctgtatgcg
tatccgctgaatccggtgaatggtattgatccattagggttaagtcccgcagatgtagcg
ctaataagaagaaaagatcaactaaaccatcaaagagcatgggatatattatctgatact
tatgaagatatgaagagattaaatttaggtgggactgatcaatttttccattgtatggca
ttttgtcgagtgtctaaattaaatgacgctggtgttagccgatcggcgaaagggctgggt
tatgaaaaagagattagagattacgggttaaatctgttcggtatgtacggcagaaaagta
aagctatcccattctgaaatgattgaagataataaaaaagacttggctgtaaatgaccat
gggttgacatgtccatcaacaacagattgctcagatagatgtagtgattatattaatcca
gagcataaaaaaacgataaaggctttacaagatgctggctatctcaagtaa
              
                            

Download fasta file
RegulonDB