RegulonDB RegulonDB 10.9: Gene Sequence
ylbG gene sequence


Size: 372        A: 93  T: 92  G: 91  C: 96

Fasta

 

>ylbG E. coli K12. Version NC_000913.3 GI:556503834
atgcttcatactgccaatcccgtcatcaaacacaaagccggtttgctcaatctggctgaa
gaactcagcaacgtatcaaaagcctgtaaaatcatgggcgtttcgcgtgatacgttttat
cgttaccgcgaactggtcgctgaaggcggtgtggatgcgcagattaatcgtagtcgccgc
gctcctaaccttaagaaccgtaccgatgaggcaactgaacaggctgttgttgattacgcc
gtcgctttcccgacacatggtcagcaccgggccagcaacgagctgcgtaaacagggggtt
tttatctccgacagtggtgtccgttctgtctggttactccataaccttgagaatctcaaa
agacgatactga
              
                            

Download fasta file
RegulonDB