RegulonDB RegulonDB 10.9: Gene Sequence
allS gene sequence


Size: 927        A: 224  T: 217  G: 250  C: 236

Fasta

 

>allS E. coli K12. Version NC_000913.3 GI:556503834
atgttcgatccagaaaccttgcggactttcattgcggttgctgaaacaggaagtttttca
aaagcggcagaacgattatgtaaaaccacggcgacgatcagttatcgcattaaacttctg
gaagagaataccggagtagcgctgtttttccgtacgactcgcagcgtgacgttgacagcg
gctggcgagcatctactttcccaggccagagactggctgagctggctggaaagtatgcca
agcgagctgcaacaggtgaatgatggcgtggaacgccaggtgaatattgtcatcaacaac
ctgctctacaacccccaggccgtcgcccagttgctggcgtggctgaatgagcgttacccc
tttacccagtttcacatctcccgacaaatctatatgggcgtctgggactcgctattgtac
gaaggtttttcgctggctatcggcgtcacgggaactgaggcgctggcaaatacctttagt
cttgatcccttaggatcggtgcaatggcgctttgtcatggcggcggatcatccgctggcg
aacgttgaagagccgctaacagaagcgcagttgcggcgctttccggcggtcaatattgaa
gacagcgcccgcaccttaaccaaacgcgtcgcctggcgattgccagggcaaaaagagatt
attgttcccgatatggaaacgaaaatcgccgcccatctggcgggcgttggcattggtttt
ttgccaaaatcgctttgccagtcaatgatcgataatcaacaactggtcagccgggtaatc
ccaacgatgcgccctccttcgccattgagtctggcatggcgcaaatttggcagcggcaaa
gcggtagaagatattgtgaccttgtttacccagcgcaggccggaaatcagcggattttta
gaaattttcggcaacccacgcagttaa
              
                            

Download fasta file
RegulonDB