RegulonDB RegulonDB 10.8: Gene Sequence
allA gene sequence


Size: 483        A: 114  T: 122  G: 129  C: 118

Fasta

 

>allA E. coli K12. Version NC_000913.3 GI:556503834
atgaaacttcaggtattaccgttaagtcaggaagcctttagtgcttatggcgacgtaatc
gaaacgcagcaacgggattttttccatattaacaatggcctggtggagcgttaccacgat
ttggcgctggttgagattcttgagcaagactgtacgcttatcagcattaaccgcgcgcaa
ccggcgaatctgccgctgaccattcacgaactcgaacgtcatccgctgggtactcaggcc
tttatcccgatgaaaggtgaggtgtttgtggtggtcgtggcgttaggtgacgacaaacca
gacctgtcaacgctgcgggcgtttatcaccaacggcgaacagggagtgaattaccatcgt
aacgtctggcatcacccacttttcgcctggcagcgcgtcaccgattttctgaccatcgat
cgcggcggcagtgacaactgtgatgttgaaagtattcctgaacaggaactctgttttgcg
tga
              
                            

Download fasta file
RegulonDB