RegulonDB RegulonDB 10.9: Gene Sequence
glxR gene sequence


Size: 879        A: 210  T: 223  G: 243  C: 203

Fasta

 

>glxR E. coli K12. Version NC_000913.3 GI:556503834
atgaaactgggatttattggcttaggcattatgggtacaccgatggccattaatctggcg
cgtgccggtcatcaattacatgtcacgaccattggaccggttgctgatgaattactgtca
ctgggtgccgtcagtgttgaaactgctcgccaggtaacggaagcatcggacatcattttt
attatggtgccggacacacctcaggttgaagaagttctgttcggtgaaaatggttgtacc
aaagcctcgctgaagggcaaaaccattgttgatatgagctccatttccccgattgaaact
aagcgtttcgctcgtcaggtgaatgaactgggcggcgattatctcgatgcgccagtctcc
ggcggtgaaatcggtgcgcgtgaagggacgttgtcgattatggttggcggtgatgaagcg
gtatttgaacgtgttaaaccgctgtttgaactgctcggtaaaaatatcaccctcgtgggc
ggtaacggcgatggtcaaacctgcaaagtggcaaatcagattatcgtggcgctcaatatt
gaagcggtttctgaagccctgctatttgcttcaaaagccggtgcggacccggtacgtgtg
cgccaggcgctgatgggcggctttgcttcctcacgtattctggaagttcatggcgagcgt
atgattaaacgcacctttaatccgggcttcaaaatcgctctgcaccagaaagatctcaac
ctggcactgcaaagtgcgaaagcacttgcgctgaacctgccaaacactgcgacctgccag
gagttatttaatacctgtgcggcaaacggtggcagccagttggatcactctgcgttagtg
caggcgctggaattaatggctaaccataaactggcctga
              
                            

Download fasta file
RegulonDB