RegulonDB RegulonDB 10.9: Gene Sequence
ybbW gene sequence


Size: 1455        A: 321  T: 450  G: 367  C: 317

Fasta

 

>ybbW E. coli K12. Version NC_000913.3 GI:556503834
atggaacatcagagaaaactattccagcaacgcggctatagcgaagatctattgccgaaa
acgcaaagccagcggacctggaaaacatttaactattttaccttatggatgggttcggtt
cataacgttcccaattatgtgatggtcggcggcttttttattctcggcttgtctaccttt
agtattatgctggcaattatcctcagcgcctttttcattgccgcggtaatggtattaaac
ggtgctgcgggcagtaaatacggtgtgccttttgccatgatcctgcgtgcttcttacggt
gtacgtggtgcactgtttcccggattattaaggggcggaattgccgccatcatgtggttt
ggtttgcaatgttacgcggggtcactggcctgcttgattctgattggcaaaatctggccg
ggatttttaactctcggtggtgatttcactctgttaggcctttctctaccgggcttaatt
actttcttaatcttctggctggtcaacgttggtataggttttggcggtggcaaagtttta
aataaattcactgccattcttaacccgtgcatctatatcgttttcggcggtatggcgatt
tgggcgatttcactggtcgggatcggtccaatctttgactacattccgagcggtattcag
aaagcagaaaacggtggcttcctgttcctggtggtgattaacgcggtagttgcggtctgg
gcggcaccggcggtgagcgcatccgactttacgcaaaacgcccactcgtttcgtgagcag
gcgctggggcaaacgctgggtttagttgtggcctatattctgtttgcggtcgccggggta
tgtattattgccggagccagtattcactacggcgctgatacctggaacgtgctggatatt
gttcagcgttgggacagcctgttcgcctcgttctttgcggtactggttattctgatgaca
actatctccactaacgcgaccggtaatattattccagccggttatcagattgccgccatt
gcaccgacaaaactgacctataaaaacggcgtactgattgccagtattatcagcttgctg
atctgcccgtggaaattaatggaaaatcaggacagcatttatcttttcctcgatattatc
ggcggaatgcttggtccggtaattggtgtcatgatggcgcattattttgtggtgatgcgc
ggacaaattaatcttgatgaactgtataccgcacctggcgattataaatattacgataac
ggttttaacctcactgcgttttcagtaactctggtggccgttattttatctcttggcggt
aagtttattcactttatggaaccgttatcgcgtgtttcatggtttgtcggcgtcatcgtc
gcctttgcggcctacgccttattaaagaaacgtacaacagcagaaaaaacaggagagcaa
aaaaccataggttaa
              
                            

Download fasta file
RegulonDB