RegulonDB RegulonDB 10.9: Gene Sequence
allB gene sequence


Size: 1362        A: 337  T: 322  G: 380  C: 323

Fasta

 

>allB E. coli K12. Version NC_000913.3 GI:556503834
atgtcttttgatttaatcattaaaaacggcaccgttattttagaaaacgaagctcgcgtt
gtagatatcgccgttaaaggcggaaaaattgctgctatcggtcaggatctgggcgatgca
aaagaagttatggatgcgtctggtctggtggtttcgccgggcatggttgatgcgcacacc
catatttctgaaccgggtcgtagccactgggaaggttatgaaaccggtactcgcgcagcg
gcaaaaggtggtatcaccaccatgatcgaaatgccgctcaaccagctgcctgcaacggtt
gaccgcgcttcaattgaactgaagttcgatgccgctaaaggcaagctgactattgatgcg
gcacaactcggtggcctggtgtcttacaacatcgaccgtctgcatgagctggatgaagtg
ggcgttgtcggcttcaaatgcttcgttgcgacctgtggcgatcgcggtatcgacaacgac
ttccgtgatgtaaacgactggcagttcttcaaaggtgcgcagaagctgggcgaactgggt
cagccggtgctggtgcactgcgaaaacgcgctgatttgtgacgaactgggcgaagaagcg
aagcgtgaaggtcgcgtaaccgctcatgactatgtggcttcgcgtccggtatttaccgaa
gtggaagcaattcgccgcgtactgtatctggcgaaagttgctggttgccgtctgcacgtt
tgccacgtcagcagcccggaaggtgttgaggaagtgactcgtgcacgtcaggaaggtcag
gacgttacttgtgaatcctgcccgcattactttgtactggataccgatcagttcgaagaa
atcggtactctggcgaagtgttcaccgccgatccgcgatctggaaaaccagaaaggcatg
tgggaaaaactgtttaacggtgaaatcgactgcctggtttccgaccactctccatgcccg
ccggaaatgaaagccggtaacatcatgaaagcatggggcggtatcgccggtctgcaaagc
tgcatggacgtgatgttcgatgaagcggtacagaaacgcggtatgtctctgccaatgttc
ggcaaattaatggcgactaacgcagcagatattttcggtctgcagcaaaaaggccgtatc
gccccaggaaaagatgccgacttcgtcttcattcagccgaatagcagctatgttcttacc
aatgacgatctggaatatcgccacaaagtcagcccgtatgttggccgtaccattggcgcg
cgtatcacgaaaaccatcttacgtggtgatgtgatttacgacattgaacagggcttccct
gttgcgccgaaaggtcaatttatccttaaacatcagcagtaa
              
                            

Download fasta file
RegulonDB