RegulonDB RegulonDB 10.9: Gene Sequence
ybbY gene sequence


Size: 1302        A: 219  T: 416  G: 340  C: 327

Fasta

 

>ybbY E. coli K12. Version NC_000913.3 GI:556503834
atgttcaattttgcagtcagccgcgaaagcctgttatcaggatttcagtggtttttcttt
attttttgcaacacggttgtggttcctcctacgctactttctgcttttcagttgccgcaa
agtagcctgcttacgctcacgcaatatgcttttcttgctaccgcactggcctgcttcgct
caggcgttttgcggtcatcgtcgcgctattatggaagggccaggtggcctgtggtgggga
accatccttactatcacccttggtgaagcatcgcgcgggacaccgatcaacgatatcgcc
accagcctggcagtggggattgcactctccggcgtgctgacgatgttgattggttttagc
ggattaggccatcgcctggcacggttatttacgccgtcggtgatggtcttgtttatgttg
atgctgggcgcgcagctgaccactatctttttcaaaggtatgctcgggctgccgtttggc
atagccgacccgaattttaaaattcagttaccgccgttcgcgctctcggtggcggtgatg
tgcctggtactggcgatgattatcttcctgccgcaacgttttgcccgttatggcctgctg
gtcggcaccataaccggctggttgttgtggtacttttgctttccttcttcgcactcgctc
tccggtgagttgcactggcagtggttcccgctcggcagtggcggtgctttgtcgccggga
attattctgacggcggtgattacaggtctggtaaatatcagcaatacctacggtgcgatt
cggggcacggatgttttttatccgcagcagggcgcagggaatacgcgttatcgtcgtagc
tttgtggcgaccggatttatgacgctgataaccgtaccgctggcggtaattccattttca
ccgtttgtttcatccattggtttattaacccagactggcgattacacgcggcgttcgttt
atttatggcagcgttatttgcctgctggtggcgctggttcctgcactcacgcgactgttt
tgcagtatccctttacccgtgagtagtgcggtcatgctggtttcttatctgcctttactc
ttttccgcgctggtgtttagccagcaaataacgtttaccgctcgcaatatttatcgactc
gcattgccgttatttgtcggcatatttttaatggcattaccgcctgtgtatctgcaagac
cttccattaacgcttcgtcctctgctcagtaacggcttattggtcgggattttactggct
gttcttatggataaccttattccgtgggaacgcatcgaataa
              
                            

Download fasta file
RegulonDB