RegulonDB RegulonDB 10.9: Gene Sequence
glxK gene sequence


Size: 1146        A: 252  T: 257  G: 386  C: 251

Fasta

 

>glxK E. coli K12. Version NC_000913.3 GI:556503834
atgaagattgtcattgcgccagactcttttaaagagagcttaagtgcagaaaaatgttgt
caggcaattaaagccgggttttcgaccctctttcccgatgcgaactatatctgtttgccg
atagcggatggcggcgaagggacggtggatgcgatggtcgccgcgacgggcggcaacatc
gtgacgcttgaagtctgcgggccgatgggcgaaaaagtgaatgctttttatggccttacc
ggcgacgggaaaacggcggtgattgagatggcggcagcaagtggcctgatgctggtcgcg
cctgaaaagcgtaatccgttgctggcctccagttttggtacgggggagttaattcgtcat
gcgctggataacgacattcgccatattattctcggcattggcggcagtgcgacggtcgac
ggcggtatgggcatggcgcaggcgctcggtgtgcgtttccttgatgccgacggtcaggcg
ctggcggcaaacggtggtaatttagcgcgcgtggcaagcattgagatggatgaatgcgat
ccgcgtctggcgaattgccatattgaagtagcatgtgacgttgataacccgctggtaggg
gcacgcggcgcggcggcggtgtttggcccgcaaaaaggggcaacgccggagatggtcgaa
gaacttgaacaggggctgcaaaattacgcccgtgttttacaacagcaaactgaaattaat
gtctgccagatggcgggcggcggcgctgcgggcggtatgggtattgcggcggcggtattt
ctcaatgcggatattaaaccgggcattgaaattgtgttgaatgcggtcaatcttgcgcag
gcagtgcagggcgcagcactggtgattaccggggaagggcgcatcgactcgcaaacggca
ggcggtaaagcgccgctgggtgtggcgtcggtggcgaagcagtttaatgtaccggtgatt
gggattgctggcgtattgggtgatggcgtggaagtggtgcaccagtacggcattgacgcg
gtattcagcattttgcctcgtctggcacctttagccgaagtgctcgccagcggtgaaacc
aatctcttcaacagcgcgcgaaatattgcctgcgccattaaaataggtcagggaattaaa
aactaa
              
                            

Download fasta file
RegulonDB