RegulonDB RegulonDB 10.9: Gene Sequence
allE gene sequence


Size: 786        A: 203  T: 220  G: 190  C: 173

Fasta

 

>allE E. coli K12. Version NC_000913.3 GI:556503834
atgggatatttaaataacgtcaccggttaccgcgaagatttactggctaaccgtgcgatt
gttaaacacggtaatttcgcactgttaaccccggatggtctggtaaaaaatattattccg
ggctttgaaaattgtgacgcgacaatcctctccacgccaaagctgggtgcctcttttgtt
gattatctggtcacactgcatcaaaacggtggcaaccaacagggcttcggtggcgaaggc
attgaaacgttcctgtatgtgatctctggaaatatcactgccaaagccgaaggcaaaaca
tttgccttaagcgaaggtggctatctttattgcccgccaggctccttaatgacgtttgtt
aacgcccaggccgaagacagccaaatctttttatataagcgccgctatgttccggtagaa
ggctatgcaccgtggctggtttctggcaatgccagcgaactggaacgcattcattatgaa
ggcatggacgatgttattctgctggattttctgcccaaagagttaggttttgatatgaac
atgcatatcctctcttttgcaccaggtgccagccacggttatatcgaaacacacgttcag
gaacacggtgcctatattctttccggtcagggggtttataacctcgacaataactggatc
ccggtgaaaaaaggcgattacatctttatgggcgcttattctttacaggctggttatggt
gtagggcgtggtgaagcgttcagctatatttactcgaaagattgtaaccgcgacgtagag
atttaa
              
                            

Download fasta file
RegulonDB