RegulonDB RegulonDB 10.9: Gene Sequence
allD gene sequence


Size: 1050        A: 259  T: 241  G: 275  C: 275

Fasta

 

>allD E. coli K12. Version NC_000913.3 GI:556503834
atgaaaatcagtcgggaaacactccaccagctaattgagaataaactctgccaggctggg
ttaaaacgtgagcacgctgcaaccgtggctgaagtattggtttacgccgatgccagaggg
atccactctcatggcgcggtgcgcgtggaatactacgcggaacgcatttcaaaaggcggc
accaaccgcgaaccggagtttcgtcttgaggaaaccgggccgtgctcggcaattttacat
gccgacaatgccgccggacaggtcgcggcgaaaatgggtatggaacatgccatcaaaacc
gcccagcaaaatggcgttgcggtggtcggtatcagccggatgggtcacagcggcgcaatc
tcttattttgtgcagcaggcagcccgcgccggattcattggcatttcgatgtgccagtcc
gatccaatggtggtgccgtttggcggcgcggaaatttactacggtactaaccccctggcc
tttgccgcgccgggagaaggcgacgagatccttacctttgatatggcgactaccgtacag
gcatggggaaaagtgctcgacgcccgctcgcgtaatatgtctatcccggatacctgggcg
gtcgataaaaacggtgtaccaacaaccgatccgttcgcggtacatgctctgctccccgcc
gccgggccaaaagggtatggcctgatgatgatgattgacgtcctctcaggcgtcttactc
ggcttaccgttcgggcgacaggttagttcgatgtatgacgatttacacgcagggcgtaat
ttggggcaattacatatagttattaatccgaactttttctcctccagcgaattattccgt
caacatcttagccagaccatgcgcgaattaaatgccattacccccgcgcccggttttaat
caggtttattatcccggacaggatcaggatattaaacaacgcaaagccgccgtcgaaggc
atcgaaattgttgatgatatttaccagtatttaatttccgacgcgctttataacacgtca
tacgaaacgaaaaatccctttgcgcaataa
              
                            

Download fasta file
RegulonDB