RegulonDB RegulonDB 10.9: Gene Sequence
fdrA gene sequence


Size: 1668        A: 377  T: 364  G: 489  C: 438

Fasta

 

>fdrA E. coli K12. Version NC_000913.3 GI:556503834
atgatccacgcctttattaaaaaagggtgttttcaggattcggtcagtttaatgattatt
tcacgaaaactcagcgaatcagaaaatgttgatgatgtttccgtaatgatgggtacgccc
gccaataaagcgttattagataccacaggtttctggcatgacgattttaataacgccacg
ccgaacgatatttgcgtggcaattcgtagcgaagcggcggatgcggggatcgcgcaggcg
attatgcagcagcttgaagaggcgctaaaacaactggcgcaggggtcaggcagcagccag
gcgttgacgcaggtgcgtcgctgggacagtgcctgtcagaaattacccgatgccaatctg
gcgctgatttcagtggctggcgagtatgcggcggagctggcaaaccaggcgctggatcgc
aacctcaacgtgatgatgttctccgataacgtcacgctggaagatgaaatccaacttaaa
acccgcgcgcgggaaaaaggcttgctggtgatggggccggactgcggtacgtcgatgatt
gccggcacaccgctggcttttgctaacgtgatgccggaaggcaatattggcgtcattggc
gcttccggtaccgggattcaggagctgtgttcgcagattgcgctggcaggggagggaatt
actcacgcgattggccttggcgggcgcgacctcagccgtgaagtgggcggcatcagtgcg
ctaacagcgctggaaatgctcagtgcagacgagaaaagcgaagtgctggcatttgtttca
aaaccacctgccgaagctgtgcgtctgaaaattgttaatgccatgaaagcaaccggcaaa
ccgacggtggcgctgtttttaggttataccccggcggtggcccgcgacgagaatgtctgg
tttgcctcctcgctggatgaggccgcacgcctggcttgcctgctttcacgcgtcacggcg
cgacgtaacgcaatagcgcctgtcagcagcggatttatttgcggtttgtataccggcggt
acgctggctgccgaagcggcgggattacttgccggacaccttggcgtggaagccgacgat
acccatcaacatggcatgatgctggacgccgatagccaccagattattgacctcggcgat
gatttctacaccgtcgggcgtccccatccgatgatcgacccaaccttacgcaaccagtta
attgccgatctcggcgctaaaccgcaagtgcgcgtgttgctgcttgatgtcgtgattggc
ttcggtgcgaccgccgatcctgccgcctcgctggtgagcgcctggcaaaaagcctgtgcc
gcgcgtttagataatcaaccactgtatgccattgccacggtgacaggcactgaacgtgac
ccgcaatgccgctcgcagcaaatcgccacgctggaagatgcggggattgcggtcgtgagt
tcgctaccggaagccaccttgctggcggcagcgttaattcatccgctctcgcctgccgca
cagcaacacacaccgtcattactggaaaacgtcgccgtgattaacatcggattacgcagc
tttgcgctggagctacaaagcgccagcaaaccggttgtgcattaccaatggtcgccagtc
gccggtggcaataaaaaactggctcgtttattagaacgtttgcaataa
              
                            

Download fasta file
RegulonDB