RegulonDB RegulonDB 10.10: Gene Sequence
sfmA gene sequence


Size: 543        A: 143  T: 158  G: 117  C: 125

Fasta

 

>sfmA E. coli K12. Version NC_000913.3 GI:556503834
atgaaattaagatttatttcgtctgcgctggctgccgcactattcgccgctacgggtagt
tatgctgccgttgtagatggcggtacaattcactttgaaggcgaactggtgaatgctgcc
tgttcagtgaatactgactcggcagaccaggttgtcacactcggtcaatatcgtaccgat
attttcaatgctgttggtaatacctctgcattaattccattcaccattcagttgaacgac
tgcgatcctgttgttgccgctaatgctgccgttgcattttctggtcaggctgatgcaatc
aatgataatttattggccattgcatccagtaccaatacaacaacagcaacgggtgtcggt
attgaaatacttgataatacatccgcaattctcaaacctgatgggaatagcttctcaacc
aaccagaacttgatccccgggaccaacgttcttcatttttctgcacgttataaaggcacc
ggtacaagtgcatcagcagggcaagcaaatgctgacgcgacttttattatgagatatgaa
taa
              
                            

Download fasta file
RegulonDB