RegulonDB RegulonDB 10.9: Gene Sequence
null gene sequence


Size: 561        A: 128  T: 138  G: 137  C: 158

Fasta

 

>null E. coli K12. Version NC_000913.3 GI:556503834
gtgacattttctttcctctgttatgccatcacccgcgctcacctggacagtatgcagcgg
agactgaagcgccgcaatgcaggcttgccgtgttgtgaggtacccggatattatcgtgag
gatgcgtcatcgccattgctccccaaatacaaaaccaatttcagccagtgcctcgtccat
tttttcgatgaactccggcaccatctcgtcaaaactcgccatgtacttttcattccgctc
aatcacgacataatgcaggccttcacgcttcatgcgcgggtcatagttggcaaagtacca
ggcatcttttcgcgtcacccacatgctgtactgcacctgggccatgtaagccgattttat
tgcctcgaaaccaccgagccggaatttcatgaaatcccgggaggtacgagtattgccgga
agcgtggcctgtatccggatgcagagtcttatccgtggaaatcgaacgcgcattactggt
tggttaccaacttgtaccagaacatgcgggccaatgcgctggctgacgcggaattacggc
gcaaggctgccgatgaactga
              
                            

Download fasta file
RegulonDB