RegulonDB RegulonDB 10.9: Gene Sequence
exoD gene sequence


Size: 264        A: 70  T: 63  G: 84  C: 47

Fasta

 

>exoD E. coli K12. Version NC_000913.3 GI:556503834
atgaaattccggctcggtggtttcgaggcaataaaatcggcttacatggcccaggtgcag
tacagcatgtgggtgacgcgaaaagatgcctggtactttgccaactatgacccgcgcatg
aagcgtgaaggcctgcattatgtcgtgattgagcggaatgaaaagtacatggcgagtttt
gacgagatggtgccggagttcatcgaaaaaatggacgaggcactggctgaaattggtttt
gtatttggggagcaatggcgatga
              
                            

Download fasta file
RegulonDB