RegulonDB RegulonDB 10.9: Gene Sequence
renD gene sequence


Size: 306        A: 92  T: 61  G: 95  C: 58

Fasta

 

>renD E. coli K12. Version NC_000913.3 GI:556503834
atgacgggcaaagaggcaattattcattacctggggacgcataagagcttctgtgcacag
gacgttgccgcggtaacaggcgcaaccgtaatcaccagcataaatcaggctgcggctaaa
atggcgcgggcaggaatcctggtcgttgatggtaaggtctggcgaacggtgtattaccgg
ttcgctaccagagaagaatgggaaggaaaggtgagcacgaatctgatttttaaggagtgt
cgccagagtgccgcgatgaaacgggtattgagggtatataaaagaacatcaatgggaaca
caatga
              
                            

Download fasta file
RegulonDB