RegulonDB RegulonDB 10.9: Gene Sequence
ybcK gene sequence


Size: 1527        A: 526  T: 458  G: 320  C: 223

Fasta

 

>ybcK E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaaagccatagcatatatgcgattttcatcaccaggtcagatgtctggcgactca
ttaaaccgacagagaagacttattgctgaatggttaaaggtaaatagtgattattatctt
gataccataacatatgaagatttaggattaagtgcattcaaaggaaagcatgcacaatca
ggagctttttcggaatttttagatgctatagagcatggttatatattgccaggaactaca
ttgttagttgaaagtctggacagactttcaagagaaaaagtcggtgaagcgattgaacgt
ctgaaattgattttgaatcacggtattgatgttataactctttgcgacaatacagtctat
aatattgactctttgaatgagccatattcattaataaaagccatacttatagcacaaagg
gcaaatgaagaaagcgagataaagtcaagtcgggttaaattatcatggaagaaaaaacgg
caggatgcactggaatcaggtacgattatgacggcgtcttgtccgagatggctctcctta
gatgacaaaagaacggcttttgttccagaccccgacagggtgaaaactattgagctaatt
tttaaactcaggatggaaaggcgctcattgaatgcaatagccaagtatttaaatgatcat
gctgtaaagaatttctcaggaaaagaaagtgcatggggaccttctgtaattgaaaaatta
ttagcgaataaagctctgataggtatttgcgtaccttcatatcgtgcaagagggaaaggg
ataagtgaaatcgctggctattatcccagagtcatatcagatgatttgttttacgctgta
caggaaattcggttggcaccttttggtattagcaatagtagcaagaatcctatgctaata
aatctacttcgaacagttatgaagtgtgaggcttgtggtaataccatgattgttcatgcg
gtatctggaagtttgcatggctattatgtttgtccgatgagaagattacatcgatgtgac
aggccatcaataaaaagagatttggttgattataatatcattaatgaattgctttttaat
tgtagcaaaattcaaccagttgaaaacaagaaagatgctaatgaaactttagagttaaaa
attattgagcttcagatgaaaattaataatttaatcgttgcattgtctgtcgcgcctgaa
gttaccgctatagcagagaaaataagactattagataaggaattacgaagggcttcggta
tcattgaaaactttgaagagtaaaggtgtaaattcattcagtgatttttatgctattgac
ttaaccagtaaaaatggacgagagttatgccgtacacttgcctataaaacattcgaaaaa
atcataattaatacggataataaaacctgtgatatctattttatgaatggcattgttttt
aaacactatcctttaatgaaagtaatatccgcccagcaggcgataagtgctctcaaatat
atggttgatggtgagatttatttctaa
              
                            

Download fasta file
RegulonDB