RegulonDB RegulonDB 10.9: Gene Sequence
ybcL gene sequence


Size: 552        A: 160  T: 158  G: 128  C: 106

Fasta

 

>ybcL E. coli K12. Version NC_000913.3 GI:556503834
atgaaaacacttatcgtttcaactgtattggcattcataacattttctgcgcaggctgca
gcatttcaggtcactagtaatgaaataaaaacaggagagcaacttacaacgtctcatgtc
ttttctggatttgggtgtgaaggtggtaatacatcgccctcattaacctggtctggtgtt
cctgaaggtaccaaaagctttgccgtaactgtatatgatccagatgcacctacaggcagt
ggttggtggcattggactgttgttaatattccagcaacagtaacatatttgcccgttgat
gcagggagacgtgatggaacaaaactgccgactggtgctgttcaaggccgaaatgatttt
ggctatgctgggtttggtggcgcatgtcctcctaaaggagataaaccacatcattaccag
tttaaagtatgggctctaaaaactgaaaagattcctgtagattctaactccagcggagcg
ttagttggttatatgcttaatgctaataaaatcgcaaccgctgagataacaccagtttat
gagataaagtag
              
                            

Download fasta file
RegulonDB