RegulonDB RegulonDB 10.9: Gene Sequence
ybcM gene sequence


Size: 798        A: 263  T: 246  G: 152  C: 137

Fasta

 

>ybcM E. coli K12. Version NC_000913.3 GI:556503834
atgctggcaagaggtaagactaacttaaagatcgaagaaatacggatgcataaacatcat
gagattcatagggttaagcctcttatgccagctttgtgtcgtatccgtcagggaaagaaa
gttatcaattgggagacgcatactttaactgttgataataatcaaataatattatttcct
tgtggttatgaattttatattgagaattatcctgaagcagggctttatcttgcagaaatg
ctttacttacccattgatttaattgagagtttccaaaaactttatacggtaactgatcaa
atacgtaacaaaacaagtttctttttacctcagaatcctgagttaatatattgttgggag
caactaaaaacatctgtttcccgaggcttctcaactaaaattcaggagcacttagcaatg
ggcgttctactttcgttaggagtgaatcatgttaatcatttacttttatcatatagtaaa
caatcattgataagtcgttgttataacctgctgctatccgaacccggcacaaaatggaca
gcaaacaaggttgctcgatatctctacatttctgtttctacattacatcgccgtctagca
agcgagggggtaagtttccaaagtatactggacgatgtgaggttaaataatgcgttgtct
gctatacaaacgacggtaaaacctataagcgagattgccagagaaaatggttataagtgt
ccttctcgttttactgaaagatttcataatcgttttaatataacaccaagagagataaga
aaagcttccagagagtaa
              
                            

Download fasta file
RegulonDB