RegulonDB RegulonDB 10.9: Gene Sequence
ybcN gene sequence


Size: 456        A: 121  T: 105  G: 112  C: 118

Fasta

 

>ybcN E. coli K12. Version NC_000913.3 GI:556503834
gtgaacctctcacaagacggcatcaaattacatcgcggcaacttcaccgctatcggtcgg
cagatccagccttatctggaggagggcaaatgctttcgcatggtgcttaaaccgtggcgt
gagaaacgcagtctttcccagaatgcactcagccacatgtggtacagcgaaatcagtgaa
tacctcatcagcaggggtaaaacgttcgccactccagcttgggtaaaagatgctctcaaa
cacacatatctcggttatgaaaccaaagacctggttgatgtcgtaaccggtgatatcacc
actatccagtcgttacgccatacctccgatcttgataccggagagatgtatgtcttcctg
tgtaaggttgaagcctgggcgatgaatattggttgccacctgactattccacagagctgc
gagttccagctgctgcgcgacaagcaggaggcgtaa
              
                            

Download fasta file
RegulonDB