RegulonDB RegulonDB 10.9: Gene Sequence
ninE gene sequence


Size: 171        A: 52  T: 36  G: 42  C: 41

Fasta

 

>ninE E. coli K12. Version NC_000913.3 GI:556503834
atggctacaccgcttattcgtgtcatgaacggacacatctacagagtaccaaatcgtcgt
aagcgtaaacctgagctgaagccatccgaaataccaacactgctcggatataccgccagc
ttggttgataaaaaatggttgcgactggcagcaaggaggagtcatggctga
              
                            

Download fasta file
RegulonDB