RegulonDB RegulonDB 10.9: Gene Sequence
ybcO gene sequence


Size: 291        A: 74  T: 62  G: 88  C: 67

Fasta

 

>ybcO E. coli K12. Version NC_000913.3 GI:556503834
atggctgatttgagaaaagcagcgcgtggtcgggaatgccaggtaagaatccctggcgta
tgtaatggcaaccctgaaacgtctgtactggcacatatccggctgactggattgtgcggc
accggtacgaaaccgccagacctgattgccaccattgcatgttctgcctgccacgacgaa
atcgaccgccgcacgcattttgttgacgctggatatgcaaaagaatgcgcgctggaaggt
atggcgagaacacaggttatctggctgaaagagggggttattaaggcgtga
              
                            

Download fasta file
RegulonDB