RegulonDB RegulonDB 10.9: Gene Sequence
quuD gene sequence


Size: 384        A: 106  T: 113  G: 105  C: 60

Fasta

 

>ybcQ E. coli K12. Version NC_000913.3 GI:556503834
atgcgtgatattcagatggttcttgagcgttggggagcgtgggcggctaataatcatgaa
gatgtgacctggtcgtccattgccgccggttttaagggattaattacttcaaaagtaaaa
tctcgcccgcaatgttgtgacgatgacgcgatgatcatttgcgggtgcatggcccgtctg
aaaaagaacaacagcgatttgcacgatttattagtagattattatgtagtcggtatgaca
ttcatgtcactggcaggtaagcattgctgctctgatggttatatcgggaaaaggttacag
aaggctgagggcataattgaagggatgttaatggcattagatatccggttagagatggat
atcgttgttaataactctaattaa
              
                            

Download fasta file
RegulonDB