RegulonDB RegulonDB 10.8: Gene Sequence
essD gene sequence


Size: 216        A: 60  T: 53  G: 59  C: 44

Fasta

 

>essD E. coli K12. Version NC_000913.3 GI:556503834
atgaaatccatggataagttaacaacgggtgtcgcctatggcacctcagcaggtagtgcc
gggtactggtttttacagctgctagataaagtcactccctcacagtgggcagcaataggt
gtgctgggtagcctggtatttggcctgctgacgtacctgacaaacctttatttcaagatt
aaagaagataagcgcaaggctgcgagaggtgaataa
              
                            

Download fasta file
RegulonDB