RegulonDB RegulonDB 10.9: Gene Sequence
rrrD gene sequence


Size: 498        A: 143  T: 118  G: 127  C: 110

Fasta

 

>rrrD E. coli K12. Version NC_000913.3 GI:556503834
atgcctccatcattacgaaaagccgttgctgctgctattggtggcggagcaattgctata
gcatcagtgttaatcactggcccaagtggtaacgatggtctggaaggtgtcagctacata
ccatacaaagatattgttggtgtatggactgtatgtcacggacacaccggaaaagacatc
atgctcggtaaaacgtataccaaagcagaatgcaaagcactcttgaataaagaccttgcc
actgtcgccagacaaattaacccgtatatcaaagtcgatataccggaaacaacgcgcggc
gctctttactcattcgtttacaacgtgggtgctggcaattttagaacatcgacgcttctt
cgcaaaataaaccagggcgatatcaaaggcgcatgtgatcagctgcgtcgctggacatac
gctggcggtaagcaatggaaaggcctgatgactcgtcgtgagattgagcgtgaagtctgt
ttgtgggggcaacagtga
              
                            

Download fasta file
RegulonDB