RegulonDB RegulonDB 10.9: Gene Sequence
rzpD gene sequence


Size: 462        A: 129  T: 96  G: 122  C: 115

Fasta

 

>rzpD E. coli K12. Version NC_000913.3 GI:556503834
gtgagcagagtaaccgcgattatatccgctctgattatctgcatcatcgtcagcctgtca
tgggcggtcaatcattaccgtgataacgcaatcgcctacaaagtccagcgcgacaaaaat
gccagagaactgaagctagcgaacgcggcaattactgacatgcagatgcgtcagcgtgat
gttgctgcgctcgatgcaaaatacacgaaggagttagctgatgcgaaagctgaaaatgat
gctctgcgtgatgatgttgccgctggtcgtcgtcggttgcacatcaaagcagtctgtcag
tcagtgcgtgaagccaccacggcctccggcgtggataatgcagcctccccccgactggca
gacaccgctgaacgggattatttcaccctcagagagaggctgatcactatgcaaaaacaa
ctggaaggaacccagaagtatattaatgagcagtgcagatag
              
                            

Download fasta file
RegulonDB