RegulonDB RegulonDB 10.9: Gene Sequence
ybcV gene sequence


Size: 411        A: 157  T: 124  G: 61  C: 69

Fasta

 

>ybcV E. coli K12. Version NC_000913.3 GI:556503834
atggctcaggttgccatttttaaagaaatattcgatcaagtgcgaaaagatttaaactgt
gaattgttttattctgaactaaaacgtcacaatgtctcacattatatttactatctagcc
acagataatattcacattgtgttagaaaacgataacaccgtgttaataaaaggacttaaa
aaggttgtaaatgttaaattctcaagaaatacgcatcttatagaaacgtcctatgatagg
ttgaaatcaagagaaatcacatttcagcaatacagggaaaatcttgctaaagcaggagtt
ttccgatggattacaaatatccacgaacataaaagatattactatacctttgataattca
ttactatttactgagagcattcagaacactacacaaatctttccacgctaa
              
                            

Download fasta file
RegulonDB