RegulonDB RegulonDB 10.9: Gene Sequence
ybcW gene sequence


Size: 207        A: 63  T: 62  G: 49  C: 33

Fasta

 

>ybcW E. coli K12. Version NC_000913.3 GI:556503834
atgaataaagaacaatctgctgatgatccctccgtggatctgattcgtgtaaaaaatatg
cttaatagcaccatttctatgagttaccctgatgttgtaattgcatgtatagaacataag
gtgtctctggaagcattcagggcaattgaggcagcgttggtgaagcacgataataatatg
aaggattattccctggtggttgactga
              
                            

Download fasta file
RegulonDB