RegulonDB RegulonDB 10.9: Gene Sequence
tfaD gene sequence


Size: 564        A: 151  T: 137  G: 163  C: 113

Fasta

 

>tfaD E. coli K12. Version NC_000913.3 GI:556503834
atgaatgcgatgggcagcgactacatccgtgaggtgaatgtggtgaagtctgcccgtgtc
ggttattccaaaatgctgctgggtgtttatgcctactttatagagcataagcagcgcaac
acccttattccagctggcttcgtggctgttttcaacagtgatgagtcatcgtggcatctc
gttgaagatcatcggggtaaaacggtttatgacgtagcgtcaggggacgcgttatttatt
tctgaactcggtccgttaccggaaaatgttacctggttatcgccggaaggggagtttcag
aagtggaacggtacagcctgggtgaaagatgcagaagcagaaaaactgttccggattcgg
gaggcggaagaaacaaaaaacagcctgatgcaggtagccagtgagcatattgcgccactt
caggatgctgtagatctggaaatcgcaacggaggaagaaacctcattgctggaagcctgg
aaaaaatatcgggtgttgctgaaccgtgttgatacatcaactgcacctgatattgagtgg
cctacgaaccctgtcagggagtaa
              
                            

Download fasta file
RegulonDB