RegulonDB RegulonDB 10.9: Gene Sequence
ybcY gene sequence


Size: 655        A: 203  T: 182  G: 136  C: 134

Fasta

 

>ybcY E. coli K12. Version NC_000913.3 GI:556503834
ataaaaaaacacagatgatggggctagaatttacacaccacttaccctaaagctttatga
ctggtgggttttgggagtatcaaatcggcttgcatggggatgtcctacaaaggaacacct
tcttccacactttctggaacatttaggtaacaaccatctggatattggtgttggaactgg
gttttaccttactcacgtacctgagagtagtctgatatctttaatggatttgaacgaagc
tagcctgaacgcggcatctacaagggctggggaatcaaaaattaaacataaaattagcca
tgatgtttttgaaccttatcccgcggcgttacatggtcaatttgattccatttccatgtc
ttaccttcttcactgcctgcctggaaatatatctacaaaaagctgtgtaatacgcaatgc
ggcgcaggccttaactgacgatggaactctatacggagccacaattcttggcgatggagt
tgtgcacaatagcttcggtcaaaaactgatgcgcatttacaatcagaaaggcatcttttc
aaacacaaaagattccgaagaaggcttaacacatatactctcagagcatttcgagaatgt
taaaaccaaggttcaaggtactgtagtaatgttttccgcttcaggaaaaaaatag
              
                            

Download fasta file
RegulonDB