RegulonDB RegulonDB 10.9: Gene Sequence
ybdF gene sequence


Size: 369        A: 100  T: 95  G: 88  C: 86

Fasta

 

>ybdF E. coli K12. Version NC_000913.3 GI:556503834
atggataagcaatcactgcacgaaacggcgaaacgcctggcccttgagttaccctttgtc
gagctttgctggccttttggcccggagttcgatgtttttaaaattggcggcaagattttt
atgctgtcgtcggagctacgcggcgtcccctttatcaatctgaagtccgatccacaaaaa
tccctgttaaatcagcaaatatacccaagcattaagccagggtatcacatgaataaaaag
cactggatttcagtgtatcccggcgaagaaatctccgaagcgttacttcgcgatctgatc
aacgattcgtggaatctggtggttgatggtctggctaaacgcgatcaaaaaagagtgcgt
ccaggctaa
              
                            

Download fasta file
RegulonDB