RegulonDB RegulonDB 10.9: Gene Sequence
ybdJ gene sequence


Size: 249        A: 41  T: 82  G: 62  C: 64

Fasta

 

>ybdJ E. coli K12. Version NC_000913.3 GI:556503834
atgaaacaccctttagaaaccttgaccaccgcagcaggcattttgctgatggctttcctc
tcttgcctgctgctgcccgcccccgcactggggctggcgctggcacaaaaactggtgacc
atgttccatctgatggatcttagtcagctttacactttattgttttgtctgtggttttta
gtgctgggcgctattgagtattttgttctgcgctttatctggcgacgctggttctcgctg
gcggattaa
              
                            

Download fasta file
RegulonDB