RegulonDB RegulonDB 10.9: Gene Sequence
ybdK gene sequence


Size: 1119        A: 261  T: 277  G: 296  C: 285

Fasta

 

>ybdK E. coli K12. Version NC_000913.3 GI:556503834
atgccattacccgattttcatgtttctgaaccttttaccctcggtattgaactggaaatg
caggtggttaatccgccgggctatgacttaagccaggactcttcaatgctgattgacgcg
gttaaaaataagatcacggccggagaggtaaagcacgatatcaccgaaagtatgctggag
ctggcgacggatgtttgccgtgatatcaaccaggctgccgggcagttttcagcgatgcag
aaagtcgtattgcaggcagccacagaccatcatctggaaatttgcggcggtggcacgcac
ccgtttcagaaatggcagcgtcaggaggtatgcgataacgaacgctatcaacgcacgctg
gaaaactttggttatctcattcagcaggcgaccgtttttggtcagcatgtccatgttggc
tgcgccagtggcgatgacgccatttatttgctgcacggcttgtcacgatttgtgccgcac
tttatcgccctttccgccgcgtcgccatatatgcagggaacggatacgcgttttgcctcc
tcacgaccgaatattttttccgcctttcctgataatggcccgatgccgtgggtcagtaac
tggcaacaatttgaagccctgtttcgctgtctgagttacaccacgatgatcgacagcatt
aaagatctgcactgggatattcgccccagtcctcattttggcacggtggaggttcgggtg
atggataccccgttaacccttagccacgcagtaaatatggcgggattaattcaggctacc
gcccactggttactgacggaacgcccgtttaaacatcaggaaaaagattacctgctgtat
aaattcaaccgtttccaggcctgtcgctatgggcttgaaggcgtcatcaccgatccgcac
actggagatcgtcgaccgctaacggaagataccttgcgattgctggaaaaaatcgcccct
tccgcacataaaattggtgcatcgagcgcgattgaggccctgcatcgccaggtcgtcagc
ggtctgaatgaagcgcagctaatgcgcgatttcgtcgccgatggcggctcgctgattggg
ctggtgaaaaagcattgtgagatctgggccggtgactaa
              
                            

Download fasta file
RegulonDB