RegulonDB RegulonDB 10.9: Gene Sequence
ybdL gene sequence


Size: 1161        A: 257  T: 279  G: 318  C: 307

Fasta

 

>ybdL E. coli K12. Version NC_000913.3 GI:556503834
atgacaaataaccctctgattccacaaagcaaacttccacaacttggcaccactattttc
acccagatgagcgcgctggcgcagcaacaccaggcgattaacctgtcgcaaggctttcct
gattttgatggtccgcgctatttacaggagcggctggcgcaccacgttgcacagggggca
aaccaatacgcgcccatgaccggcgtgcaggccttgcgcgaggcgattgctcagaaaacg
gaacgtttgtatggctatcaaccagatgccgatagcgatatcaccgtaacggcaggggcg
acggaagcgttatacgcggcgattaccgcactggtgcgcaatggcgatgaagtgatttgt
tttgatcccagctatgacagttacgcccccgccatcgcgctttctgggggaatagtgaag
cgtatggcactgcaaccaccgcattttcgcgttgactggcaggaatttgccgcattatta
agcgagcgcaccagactggtgatcctcaacactccgcataaccccagtgcaactgtctgg
cagcaggctgatttcgccgctttgtggcaggcgatcgccgggcacgagatttttgtcatt
agcgatgaagtctacgagcacatcaacttttcacaacagggccatgccagtgtgctggcg
catccgcagctgcgtgagcgggcagtggcggtttcttcatttggcaagacctatcatatg
accggctggaaagtgggttattgtgttgcgccagcgcccatcagcgccgaaattcgcaag
gtacatcagtatctgaccttttcggtgaataccccggcacagctggcgcttgctgatatg
ctacgtgcagaacctgagcattatcttgcgttaccggacttttatcgccagaagcgcgat
attctggtgaatgctttaaatgaaagccggctggagattttaccgtgtgaaggtacatac
tttttgctggtggattacagcgcggtttctaccctggatgatgttgagttttgccagtgg
ctgacgcaggagcacggcgtagcggcgattccgctgtcggtgttttgcgccgatcccttc
ccacataaactgattcgtctctgttttgccaagaaggaatcgacgttgctggcagcagct
gaacgcctgcgccagctttag
              
                            

Download fasta file
RegulonDB