RegulonDB RegulonDB 11.1: Gene Sequence
ybdO gene sequence


Size: 903        A: 282  T: 272  G: 155  C: 194

Fasta

 

>ybdO E. coli K12. Version NC_000913.3 GI:556503834
atggccaatctctacgacttgaaaaagttcgacttaaatcttcttgtcatatttgagtgt
atttaccagcatttaagcattagcaaagctgctgaatcactatatatcaccccatcagcc
gtgagccagtcgttacaacgcttacgtgcgcaatttaatgaccctttattcattcgctca
ggaaaaggtatcgcgccgacgacaacagggttaaatctgcatcaccatcttgagaaaaat
ctcagaggccttgaacaaacaattaatatagtcaataagtccgaactaaagaaaaacttt
attatctacggccctcagctcatttcttgctctaataatagtatgctgatccgctgccta
cggcaagattcctctgtcgagattgagtgccatgatatcctcatgtcagcagagaatgct
gaagaactgttggttcaccgcaaagccgatctggtgatcacccaaatgccagtgatcagc
cgttccgtcatttgcatgccattgcatacgattcgcaatactctaatttgtagtaatagg
catccacgaattactgacaatagcacttatgaacaaattatggcagaagagttcacccaa
ttaatatctaaatcagcaggggttgatgatattcaaatggaaatagacgagagatttatg
aatcgcaaaatctcatttcgtggttcctctttgctgacaatcattaatagcattgcagtt
acagatttactgggaatagtcccctatgaactttataattcctaccgtgactttcttaac
ttaaaagagataaaactagaacatccgttaccttcaataaagctttacatttcctataat
aaatcttctttaaataatttggtgttctcccgatttattgaccgtctaaatgagagtttt
tga
              
                            

Download fasta file
RegulonDB