RegulonDB RegulonDB 10.9: Gene Sequence
uspG gene sequence


Size: 429        A: 101  T: 114  G: 107  C: 107

Fasta

 

>uspG E. coli K12. Version NC_000913.3 GI:556503834
atgtataagacaatcattatgccagttgatgtatttgaaatggaattgagcgacaaagct
gttcgccacgctgaattcctcgcccaggatgacggagttattcatctacttcacgtacta
cccgggtcagccagcctgagcctgcaccgttttgccgctgatgtgcgtcgttttgaagag
catctgcaacatgaagcacaagaacgtctgcaaacgatggtcagccacttcaccatcgat
ccttcccgcattaaacaacatgtccgttttggtagcgtgcgggatgaagtcaatgagttg
gcagaagaactgggggctgatgttgtagttattggttctcgcaacccatcgatttcgacc
catctgttaggttctaacgcctcgagcgtgatccgccacgccaatctgccggtgctggtt
gtgcgttaa
              
                            

Download fasta file
RegulonDB