RegulonDB RegulonDB 10.9: Gene Sequence
ybdR gene sequence


Size: 1239        A: 311  T: 307  G: 354  C: 267

Fasta

 

>ybdR E. coli K12. Version NC_000913.3 GI:556503834
atgaaagcattgacttatcacggcccacatcacgttcaggtagaaaatgttcccgatccg
ggcgttgaacaggcagatgatattattctgcgtattacggcaacggcgatctgtggctct
gacctccatctttatcgaggcaaaatacctcaggttaaacatggcgatatttttggtcat
gaatttatgggggaagtagttgaaaccggaaaggacgtaaaaaatttgcaaaaaggcgac
cgagtggtaattccgttcgtcattgcttgtggcgactgttttttctgtcgattgcaacaa
tatgccgcctgcgaaaataccaatgcgggtaaaggcgctgcgctcaataaaaaacagata
ccagctccagcggcattgtttggttatagtcacctgtatggcggcgttcctggtgggcag
gcggaatatgtccgcgtccctaaagggaatgtggggccgtttaaagtaccgcctttgctt
tcagatgataaagcgcttttcctttctgatattctgccaacggcatggcaggcagcaaaa
aatgcgcagatccaacaaggttcaagcgttgcagtctatggtgctggtcctgtgggattg
ttgacaatcgcctgtgcacggttgctcggtgcggaacagatttttgttgttgatcatcat
ccctaccgcttgcatttcgccgccgaccgctacggcgcgatcccgattaattttgatgaa
gacagcgatccggcacagtcaattattgaacaaacggcaggtcaccggggcgtggatgca
gtaatagacgccgtcggttttgaagcgaaaggcagcaccacggaaacggtgctgactaac
ctgaaactggagggcagcagcggtaaagcgttgcgtcagtgtattgcggcggtcaggcgt
ggcggcattgttagcgtaccgggcgtctacgctggatttattcacggtttcctgtttggc
gacgcctttgataaagggttgtcgtttaaaatgggacagacccacgttcacgcatggctg
ggagaattattaccgttaattgagaaaggattactgaaaccagaagaaattgttacccac
tatatgccgtttgaagaggccgcccggggatatgagattttcgaaaaacgtgaagaggag
tgccgtaaggtgattctggtacccggtgcacaaagcgcagaggcggcgcagaaggcggtt
tcaggtctggtgaatgcgatgccggggggaacaatatga
              
                            

Download fasta file
RegulonDB