RegulonDB RegulonDB 10.10: Gene Sequence
rnk gene sequence


Size: 411        A: 96  T: 90  G: 112  C: 113

Fasta

 

>rnk E. coli K12. Version NC_000913.3 GI:556503834
atgtccagaccaactatcatcattaacgacctggatgccgaacgcatcgatattctgctg
gagcaacccgcctatgctggtttgccaatcgccgacgcgttaaacgcagagttggatcgc
gcccaaatgtgttcgccagaagagatgccacacgacgtggtgacaatgaacagccgggtt
aaattccgcaatcttagcgatggcgaagtgcgtgtgcgcacgctggtgtatccggcaaaa
atgaccgatagcaatactcagctttccgttatggctccggtaggtgccgcactgctgggg
ctgcgcgttggcgattccattcactgggaacttccgggcggcgttgcaacccaccttgaa
gtgctggaactcgaataccagccagaagctgctggcgactacctgctttaa
              
                            

Download fasta file
RegulonDB