RegulonDB RegulonDB 10.9: Gene Sequence
citT gene sequence


Size: 1464        A: 291  T: 432  G: 398  C: 343

Fasta

 

>citT E. coli K12. Version NC_000913.3 GI:556503834
atgtctttagcaaaagataatatatggaaactattggccccactggtggtgatgggtgtc
atgtttcttatccctgtccccgacggtatgccgccgcaggcatggcattacttcgctgtg
tttgtggcaatgattgtcggcatgatcctcgagccaattccggcaacagcgatcagtttt
attgcggttactatttgcgttattggcagtaattacctgctctttgatgccaaagaatta
gctgacccagcgtttaatgcgcaaaaacaggcgctgaaatggggcctggctggtttttcc
agcaccacggtatggctggtatttggcgcatttatttttgcattagggtatgaagtttcc
gggttaggtcgtcgcattgcccttttcctggtgaaattcatgggcaaacgcacgctgacg
ttgggttatgcgattgtcattatcgacattctgctggcaccgtttacaccttccaacacc
gcgcgtaccgggggtacggtttttccggtcattaaaaacctgccgccgttgtttaaatca
ttcccgaacgatccgtccgcgcgtcgtattggcggctatttgatgtggatgatggtcatt
agtaccagtctgagttcgtccatgtttgtcaccggtgcggcaccaaacgtgctgggtctg
gagttcgtcagcaaaattgccggtatccagattagctggttgcagtggttcctctgcttc
ctgccggttggggttatcttgcttatcattgcgccgtggctttcctacgtgctgtacaaa
ccggaaatcacacacagtgaagaagtggcaacctgggcgggtgatgaactgaaaaccatg
ggtgcgctgacacgcagagagtggacactgattggccttgtattgctcagcttaggtttg
tgggtatttggcagtgaagtcattaatgctactgcggttggtctgctggcagtttcgcta
atgctggccctgcacgttgtgccttggaaagacattacccgctataacagcgcatggaac
acactggtcaacctggcaactctggttgtgatggctaacggcctgactcgttctggtttt
attgactggttcgccggtaccatgagtacgcacctggaaggattctcaccaaacgcaacg
gtgattgtactggttctggtgttctactttgcacactacctgtttgccagcctgtctgcg
cacaccgcaaccatgctgccggttattctggccgtcggtaaaggtattccgggcgtacca
atggaacaactgtgtatcctgctggtgctgtctatcggtatcatgggctgtctgacgccg
tatgcaaccggtcctggggtgattatttacggctgtggctatgtgaaatcaaaagattac
tggcgtcttggcgcaatcttcggggtgatttacatctctatgttgctgttggttggctgg
ccgattctcgccatgtggaactaa
              
                            

Download fasta file
RegulonDB